Transcript Details

Vun_T22848.3 Predicted as a transcription factor   
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
Warning: Program was expecting 11 probes for the probeset ID but got 1 from the database.

>Vun_T22848.3
GTACAAAAATAAATGCATTACAAGAATCCAATGAAGAATTTGGCAACTTAATCCACGATTTGAGTGAAAAAATTGATCAAAACTCTGTCGACTCAGTTCA
ACATTGAAAGTAAGTCAACGACTAAATGAGTAAACAGCAAAACCTATGGGTATCGGTTCAAATGAAAAAACTTAAGGTTACCATGACATAATTTAATCAC
GAAAAATTAACACCTGCACTTTCATTTTAGGCATCATCAAAAGTCTCAAATGGACAACAATGTCAGGATCCAAAAATCTGCTCTCTAACTTGAGATTTAA
TTTAACGATAAGAAAAAAAGGATTACAGAACAAGATATACCATGTTATTGCCGCTTCCTCCTATAAAAATATACAACACCAATTGTGTCAATTCTATTTG
TTTCTTTGACGAAATAAGACGGCAGCAGCGGCAACAGCAGACAAACTCCAAAAGAAAGAATTATGTTGATGATAACCGTCCACTTAAAGAGTGAAACTCC
TCTCTCCTTAAAGACACATCTACAGTGACAGCAGAAAGCAGTAACTACAAACAAAGGGATATATGAAGTTACAAAAAATAATCTGGAGTCTTGCGTGTGG
TGTCAGGCTCAATTTGCCTGGGAGCTGGATCAAACTGAAGAAAACTCTGATCCATATTCTCTCCTATTTCTAGTATGGCAGCCATATTCCCACATCGGTA
ACAGTAATTTGGAGCACTAAATACGGTAACCACATTCTTGTCCTGGCACCAATTGTATCCTTCCATAACAAGCTGATGAGCTCTAGATATCAGGGAGAGA
CCATTGGTATGATTAAACTGAGTAGCAATATCCTGTCCAAATGTGTATCCTGCCCCACGGGGAGATATTCCCCATCCACAGCGATCATCAGGGTCAGACC
ACAATAGATCACACATTGGTCCTTCATGTGGAACCTCTTGTATACGATCCAATGCCCTGATGTTATCCAGCGTATCCAAAGAAGGTGAGAGACCTCCATG
CAAGCAGAAAATCTGACTCTCAATAAGGGCAGTCAAAGGCAAATAATCAAACAAGTCGGTAAAGAATTTCCAGACATTAGCATTTCCATATTTTCTCAAA
CATTCATCGTAGAACCCATACACTTGAGTGATTTGACGACTCTCATGATTTCCCCTAAGGATTGTAATTCTATCTCTATAACGGACTTTCAAGGCCACCA
AAAGTGTAACAGTCTCCACTGAATAGTAGCCACGATCTACATAATCGCCCATGAAAAGGTAGTTGGTATCGGGAGCGCTTCCTCCTATCCGAAAAAGCTC
GATGAGATCATAAAACTGGCCGTGAATGTCACCGCACACGGTGACGGGACACTTCACCGGTTGAACGTTCCACTCTTCGACGAGAATCGCCCTGGCCTGA
TCGCAAAGCGCCTTCACCTCCAGCTCCGACAGAGGCTTGCACTCCATGAGATGCTCGATCTGCCGGTCCAGATCCGCGTGAGACGGCATCGTTTCGGTCG
GTCAGATCCGAGATCCGAAGTTCCTAACAGATCAGTGGTGTTCGGTTCGGGCTAGTCCGACCGGATAGCCGGCAACGACGACCGGAGGATCCTCGCGAAA
GGGAGGGTTCCGATGCGAAGCGAGGAAGGCAAAACGAACCGTTTTGTGGGCGATGGTGTTTGGCTCTTTTTCTTCGCTCTCCTCTCAATCATTTCATTTG
GTTCCGCCCTCTGTGTTTGTTTCTGTCTTTTTCTTTTCTTCTTTGTTTCCCTCAGATTTCTTTTTTCAATTTTATGTGTGCAAAACAGAAAAAACAATAA
GCAATCAATGGAGACCTAAAAAAGAAAATTGTAAGAAACAAAAAATAACACTTTTTTAGTTTTTTTATTATGTTATTTGCT

Probe Details:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Vun_T22848.3::
Initial annotation during chip design
Database error. No record found.
Gene mapping & annotations
Mapping probeset to CDS ( Strategy )
No gene mapped to this probeset (database reported 'No record found.')Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset (database reported 'No record found.')
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
No information available.
Transcription factor prediction and categorization
Family: Search
Evidence


This page is generated by the Vigna unguiculata gene expression atlas web server at https://vugea.noble.org

© 2016 by The Samuel Roberts Noble Foundation, Inc.