Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T04485.2 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
CATTGGTGTTCTCACCTTAACCAGTAAAACCACGCTATGTTCTTAAGATTGTTTTGTTGTGGGCGACAAGTTCAAGAACATGGTTCATGTAGTTTTGCGT
TTTCGCAACAGAAAAAGAGTATGGTAGAGGAGAAGAGAGCACCACAGAAACAATGCGCGCCATTCCAGTTTCCTCAGAATCACGCTCAGCTTTTCTATTC
CCTCAACCACTCGCTTCCTTCTCCTCTAACTCCATTCCCATAACCCACTCCTCTCTCTTCTTCTTCCACCCTTTTCATTTCAAGACCCATCATTCACTAT
CCACTCCCAAACCTTGCTCCTCCAACTCCACACCCTTCTTGTGCACTGCTGCTTCAGAACCCGACCCCATCACTTTAGACGATGTGGGGCTTGAAGAGTC
GGAAGAGTCCTTAGTTGAGGATGGGGTGTGCATAGAGGTGATGAAACTGGACAAGAACTCGCGCAGAATCGAATCCAGAATTTCCATTGAAGCTTCTCTT
TCTTCCGTTTGGAACATCTTGACCGATTATGAGAGATTGGCTGATTTTATCCCTGGCCTTGCTGTCAGTCAGTTGCTCCAAAAGGGTGACAATTATGCCC
GTCTTTTGCAGGTTCCTCTCTATCACGTGTTGTGCTCCAAAAGGGGTTCTTAAAGTTTGATCTTTTTTTATGAAATTAGTTGCATTTTTTTGGCTGTTTG
TCTCACGCTGCATTCTGCTGATTTGATCAATCTCAAATAAGGTGTTAGGGTTGTTTTGGGCTTGCTTTCATTTTCTGAATCAAAAATTCTTGATTCTTTA
TTAATTTGGAGATGTAATTAGAGTATTTCTTTATGTTCTTGTTGAAGTTTATTTGTATTGGACAACCCTCGTGAGGACTTGTGCAGTAAGTGTACAAGTT
TAATTGCTTTCTGTGTTGCTATTGCTATGTAGGGATCTTCCTTTACTAGATGGTTTATTTTGCTTCTCTGTAATGGAACCCGTGGTCCTTATTACCTAGC
CGCCCGAAAATTGCTATGTAAACAAGAGGGCGCTTATGAATGTTTAGTAACAACTTGTTAGAGCTTTGTCCTGTACTTCGTTCTTTCTTTTTGTTGTTCC
ATGAATTGTTAGAAAACAAGCATAGAACAAGTGTTTTTAAAACAAGAGTGATTTTTTAGAAAACAAGCTCCATTTTGGTATAAAATCAAATGCAGGTTAG
GCATCAATTCAGGGTGATGATGATGGCATGATGCATTATGATGTATCTACAACTTAGAAGTACATGAATACTAATGTTACACTTTTTTGGTGCAGCAGTT
TACTCTGGAAATCAGAGTGTGAGCATGTATGCTCATATTACTATTATAGTTTGGGTGACAATGAATGATTCAGGTTAATGTCAAACTTTTTATAAGATTA
CATTGTTGTAAGGCCAACCATGGTTTTACCTAATTTACTTCCTCTGAATTGCAAGCTTTACAAATTAATGTCACTCAATGTTTTATTTTACTGTTACCCG
AATTAAAAATTGACATCATTTAAAGTATTTTCTTAGCTAATGTATTTGACTTGAAATTATATTTGTTATTGTTACATTACCTGAACAGATCGGACAGCAA
AATATAGCATTTGGGATAAAATTCAATGCTAAAGGAATTGTAGATTGTTATGAGAAAGAATTGGAGACTCTTCCTACTGGTATTAAGCGTGAAATTGAAT
TCAAGATGATTGAAGGAGATTTTCAACTCTTTGAAGGAAAATGGTCGATTTTGCAGCATTTGAACAGCGAAAATTGTGAGCAGTCTCAAGTCCGAGAAGT
TAGTACAACTCTCTCATACGTTGTTGATGTTAAGCCGAAGCTGTGGTTGCCTATTCGTCTCATAGAGGGTAGACTTTGCAATGAGATAAAAATGAACCTT
GTATCTGTCAGGAACGAAGCTCAAAAAGAACGAGTTGTGTAATTAATGGATATATTGTGGATCATACAAAAATGAATACAAGTCCAGTTTACTCCTCTTT
GCTCATTTGGTAAATCTTTATGCTTGGTCTTACATGCCCTCTTCATAAGAATTTCTTCAATGTCTGCCCTCCTTGATCTTTACATTCAAGGCTGAATCAA
TATTCATATTAGAGTTGTTGGATGTTGGATTTGAACTGAGTATAAAATTGGGGTGGTTCCAAGTATTAGAGTTTAATTAAGTTTGTTATGAGTTAGCTAA
GTTAGTGATGTATATAAAATCAGTGCCTGTGTAATATTTTTTTTATGAGATTTTATTCAATGAATTATATGAACTTAGGTAGGGCTCAAGACAATGATTT
TGTAAATTTTCATCTACATTGCCGCAACATAGTTTTATACAGTCCAAGAATGACTATTTGTTATTCACACAGG
Putative annotation

Gene mapping
AT4G01650.2 Polyketide cyclase / dehydrase and lipid transport protein
Medtr1g085550.1 polyketide cyclase/dehydrase and lipid transporter
Glyma10g28000.1_PACid:16280166 unknown protein
Functional annotation (GO and Pfam)
GO:
Pfam:
PF03364.15 Polyketide_cyc Polyketide cyclase / dehydrase and lipid transport 112-147 E:2.1e-07
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC