Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T09910.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
ATCCACACGTGTTTAACACAAGCAATAGTTTCTCCTAAACCATAATAATGAATTATAAAAGCAACCACCCACCTTTCGAAACAAAAACCAAACAAACAAC
CTTCTACAAACTCATAGGTTATTTTCTGTTGCCTCCATTGTCATCTTCTTCTGTCTGTGTTCCTCACCTTGTCCAAAAAACCTCTTCCCATGGAGTCATC
ACCGCCACCAACAACAACAACCACCCACATAGCCCTAGTTTCCGTCCCTGCTTTCAGCCACCAAGTCTCGATCCTCGAGTTCGCAAAACGCCTCCTCCAT
CTCCACACCGACACCTTCCACGTTACATGCATCATTCCCACACTCTCTTCTTCCTCTTCCAAACACTCCTTCTTCTTCGATTCCCTCCCTCGCAACATTC
ACTGCATCTTCCTCCCCTCAGTCAACTTCCAAGACCTGAACAACAATGGCGCCTCCGTCGAAATCCAGACTCAGCTCTCAGCCTCTCGAGCCATGTCCTC
CGTCAGAGAAACCCTAGTTTCACTCTCCAGAACCACTGCCATCACTGCTCTCATTGCTGATGCCATGGCCCCCGAGGCTCTGGAGCTTGGCAAGGAACTC
AACATCTTGTCCTACATATACTTCCCTTGCTCCACCATGGTCCTGTCCATTTGCTTCCATTCCCGAAACCTCGACCACGAGGTTTCGTGTGAGTACAAGG
ATCATCCTGGTCTGATTCCCCTCCCCGGTTGCATCTCTATCTCTGGCAGAGATCTTCCAGACAGCATGCAAGATAGAGGAAGTTTGGCATACAAGCTTTT
CCTCCAACGATGCCAGAGATACCTCGATGCTCATGATGGTATATTGGTGAACAGCTTCATGGAATTGGAAGAAGAAACAACAAAAGCAATATCTGAACAT
GAACATGGTAATGGTAATGAACATGGTAATGGTGCTGGTAATGGTAATGGTGGTGATTACCCTCCTGTGTATTTAGTTGGGCCCATCACACAGAGTGGTT
CAAGAAGTAGGTGTGAGTGTTTATTGTGGTTGGATAAACAACAACCTGATTCAGTTCTTTATGTGTCTTTTGGGAGTGGTGGCACACTTTCCCAGGAGCA
GATAAACGAACTTGCATTAGGGTTAGAGTTGAGCAAGCACAAGTTTCTGTGGGTGAATCTGAGAGCACCAAATGATAGGGCAAGTGCTACTTATTTCAGT
GATGGGGGTTTGGTGGATGATGATGATGATCCTCTGCAATTTTTGCCAAAAGGGTTTCTAGAGAGGACGAAGGAGCAGGGTTTGGTGATGTGTGGGTGGG
CCCCACAAGTGGAAGTGCTTGGACACAGGTCAATTGGTGCATTTCTGAGTCACTGTGGTTGGAACTCGGTTTTGGAGAGTGTGGTGCATGGAGTGCCGAT
GATAGCATGGCCTTTGTTTGCTGAACAAAGAAGCAATGCAGCTTTGGTGAGTGAAGGATTGAAAGTTGCTCTGAGGGCAAAGATGAAGAACCCTAGAGGG
AAGAGCAATGGTGTGGTGGTGAAGGAGGAGATTGTTGAACTGATAAAGGGTGTGATGGAGGAGGGTTTGGAGGGTGAAGAAATCCGCAGGAAAGTGAAGG
AACTGAAGAAGCTTGCAAACTGTGCAATGATGGAAGATGGGTCCTCAACAAGGACAATAGAAAAGTTGGTAAATAAGTGGAAACGTTTGGGAAAATCTTT
GTAGAAGAATATATAAACGTGGAAGAAATCATCACCTGAGAAAGTAGTTCCACCAGATTCTCAGTTTCTTTGTTTTATTGTTGATTGATCATGTTAATGA
TTGAGGCTTTGTTTGATTAGGTTTTGATTAGGTTTTGAGTTTATCCATTGATTGAGTACTACCTTTTGGAGAGATCGATGAAATCAAAATAAAACACAGT
ACTATCATAAAGTTATTCTATTCATTTCATCTCATTGTTTACTATCTTTTGGAGAGATCGATGAAATC
Putative annotation
HQGT_RAUSE HQGT_RAUSE Q:226-1683,H:6-464 45.12%ID E:6e-123 RecName: Full=Hydroquinone glucosyltransferase; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; asterids; lamiids; Gentianales; Apocynaceae; Rauvolfioideae; Vinceae; Rauvolfiinae; Rauvolfia
Gene mapping
AT4G01070.1 UDP-Glycosyltransferase superfamily protein
Medtr8g006260.1 UDP-glucosyltransferase family protein
Glyma07g14530.1_PACid:16267277 "GT72B1; UDP-glucosyltransferase/ UDP-glycosyltransferase/ transferase, transferring glycosyl groups"
Functional annotation (GO and Pfam)
GO:
GO:0050505 molecular_function hydroquinone glucosyltransferase activity
GO:0016758 molecular_function transferase activity, transferring hexosyl groups
GO:0008152 biological_process metabolic process
Pfam:
PF00201.13 UDPGT UDP-glucoronosyl and UDP-glucosyl transferase 277-421 E:1.3e-24
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC