Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T22848.3 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
GTACAAAAATAAATGCATTACAAGAATCCAATGAAGAATTTGGCAACTTAATCCACGATTTGAGTGAAAAAATTGATCAAAACTCTGTCGACTCAGTTCA
ACATTGAAAGTAAGTCAACGACTAAATGAGTAAACAGCAAAACCTATGGGTATCGGTTCAAATGAAAAAACTTAAGGTTACCATGACATAATTTAATCAC
GAAAAATTAACACCTGCACTTTCATTTTAGGCATCATCAAAAGTCTCAAATGGACAACAATGTCAGGATCCAAAAATCTGCTCTCTAACTTGAGATTTAA
TTTAACGATAAGAAAAAAAGGATTACAGAACAAGATATACCATGTTATTGCCGCTTCCTCCTATAAAAATATACAACACCAATTGTGTCAATTCTATTTG
TTTCTTTGACGAAATAAGACGGCAGCAGCGGCAACAGCAGACAAACTCCAAAAGAAAGAATTATGTTGATGATAACCGTCCACTTAAAGAGTGAAACTCC
TCTCTCCTTAAAGACACATCTACAGTGACAGCAGAAAGCAGTAACTACAAACAAAGGGATATATGAAGTTACAAAAAATAATCTGGAGTCTTGCGTGTGG
TGTCAGGCTCAATTTGCCTGGGAGCTGGATCAAACTGAAGAAAACTCTGATCCATATTCTCTCCTATTTCTAGTATGGCAGCCATATTCCCACATCGGTA
ACAGTAATTTGGAGCACTAAATACGGTAACCACATTCTTGTCCTGGCACCAATTGTATCCTTCCATAACAAGCTGATGAGCTCTAGATATCAGGGAGAGA
CCATTGGTATGATTAAACTGAGTAGCAATATCCTGTCCAAATGTGTATCCTGCCCCACGGGGAGATATTCCCCATCCACAGCGATCATCAGGGTCAGACC
ACAATAGATCACACATTGGTCCTTCATGTGGAACCTCTTGTATACGATCCAATGCCCTGATGTTATCCAGCGTATCCAAAGAAGGTGAGAGACCTCCATG
CAAGCAGAAAATCTGACTCTCAATAAGGGCAGTCAAAGGCAAATAATCAAACAAGTCGGTAAAGAATTTCCAGACATTAGCATTTCCATATTTTCTCAAA
CATTCATCGTAGAACCCATACACTTGAGTGATTTGACGACTCTCATGATTTCCCCTAAGGATTGTAATTCTATCTCTATAACGGACTTTCAAGGCCACCA
AAAGTGTAACAGTCTCCACTGAATAGTAGCCACGATCTACATAATCGCCCATGAAAAGGTAGTTGGTATCGGGAGCGCTTCCTCCTATCCGAAAAAGCTC
GATGAGATCATAAAACTGGCCGTGAATGTCACCGCACACGGTGACGGGACACTTCACCGGTTGAACGTTCCACTCTTCGACGAGAATCGCCCTGGCCTGA
TCGCAAAGCGCCTTCACCTCCAGCTCCGACAGAGGCTTGCACTCCATGAGATGCTCGATCTGCCGGTCCAGATCCGCGTGAGACGGCATCGTTTCGGTCG
GTCAGATCCGAGATCCGAAGTTCCTAACAGATCAGTGGTGTTCGGTTCGGGCTAGTCCGACCGGATAGCCGGCAACGACGACCGGAGGATCCTCGCGAAA
GGGAGGGTTCCGATGCGAAGCGAGGAAGGCAAAACGAACCGTTTTGTGGGCGATGGTGTTTGGCTCTTTTTCTTCGCTCTCCTCTCAATCATTTCATTTG
GTTCCGCCCTCTGTGTTTGTTTCTGTCTTTTTCTTTTCTTCTTTGTTTCCCTCAGATTTCTTTTTTCAATTTTATGTGTGCAAAACAGAAAAAACAATAA
GCAATCAATGGAGACCTAAAAAAGAAAATTGTAAGAAACAAAAAATAACACTTTTTTAGTTTTTTTATTATGTTATTTGCT
Putative annotation
PP2A_HEVBR PP2A_HEVBR Q:1489-575,H:1-305 95.08%ID E:0 RecName: Full=Serine/threonine-protein phosphatase PP2A catalytic subunit; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Malpighiales; Euphorbiaceae; Crotonoideae; Micrandreae; Hevea
Gene mapping
AT1G10430.1 protein phosphatase 2A-2
Medtr5g037200.1 serine/threonine protein phosphatase 2A
Glyma02g02990.1_PACid:16246794 PP2A-2; protein serine/threonine phosphatase
Functional annotation (GO and Pfam)
GO:
GO:0005737 cellular_component cytoplasm
GO:0046872 molecular_function metal ion binding
GO:0004721 molecular_function phosphoprotein phosphatase activity
GO:0016787 molecular_function hydrolase activity
Pfam:
PF00149.23 Metallophos Calcineurin-like phosphoesterase 48-240 E:2.3e-40
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC