Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T02696.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
CTCAAAAAAGTGTTAAAATATATATAATGTTCAATTAGCTAACTTTAGAGGCTGAATGCGCCAAAGTATGGAAAAAAATTATTGAAATGTTGATAATAGA
TATTAAAAGGTTAATGTACATAAAATAATGTATTATTTGGGAACCATGTTTTTTCGTTCAGTGTAAGTTAGAAATTGTTCATACAACAAGTATTCTTCAT
ACAGGTAGCTGTTTATACTCTGCCAAAAGTTTTGGAATATCGTCCATGCGCAACTGAGTAGCATTTTTGACGTGGTAAAATTGATGCAGCACGTGTTCAC
CAAATCCAGGCTTCTGAACAGATGCATTCCTTTCTAGATAGTGCCTATATATGAGACGTTGGTAATCCCGAAGCAATGGTCCAAGCTCTTTGAGTTTAAC
CATATTTGGTTCAGAGTTTCTCCAGTGTTTACGAATTGTTAAGATCGCCAGTGAATTAGTAGAAACGTTTTCACCTGCTAATCTTGATGCTACTTCAAGC
AGCTCTTTATCTTCGAACTCATTTACAATCTCAAGGCTGGAACTGGAAACTGATATTTGCAACCGTCTTTGTAGTTCAGAGAAAGGAAATTTCTCTGTTT
GGCTTTCCTTTAGTTGAGGTTGAAAATCATCGTTAAAAGCAAATTCCTTACTTTCAGCAATATTTCTGGGTGGAGCTGCAGTTAATCTATTTGCAATTGG
GTCCTCTTGAGGGACTAACCACCATGGATCACCATAAGTCGTTTTCCCATCAAAACCACCAATTAGCAGATACCGTGGTCCAACAACTGACATAGAGTGG
TACGCTCTAGCAGGAGGGGGTTCACTGCCTATGGAGAGGCGTTTCCACTGTGCTGAAACTCTGTCTAATATAATGCAGTCGTTGTAATAGATATCATAAC
GACTCAACCATCCACCAGTCCCATGTCCTCCAAACATCAACAAATAATGTCCTCCAGACGTAACTGTATGGCCACATCGGGGAGAAGGTGCTTGACCTGG
AAGCTTTAATTGAGTCCATCCAGGTGCTTCATTCTCTTCTTCAATTAGGCCCTTCAAAGCCCATAAATCACCCATAATAGGTCCGCCTCCTCCTCTTCCA
CCATATACAAGCAATCGTTTTTCAACCATAGTGGCAGTATGCCCACATCTGGGCTGTGGCAATGTTCCAGAAACTGAGAGCTCCATCCACTCAAGCGAAA
TAGTGTCCAAGACATAAACATCAGATAACCACTTCTTTCCGTCCCATCCACCATACATAACAATTTTTCGGTTTCCAACAGCCGAAGCTGCAGCGAAATC
CCGAGGTGATGGCAAGTCTCCAAATCCACTTAGTTCAGACCATTGCCATATGTCAGTATCCAAAACCCAAAAGTCCCCCAACCTCTGACTTCCAAAACGA
CCACCAAAGATGAACATGTGACAATCAATGGAAACAGCGACATGGAAAGCCCGAGGGCTGGGACCTACATGCTCATCTGACCCACTTCCAGTGCACTCAG
GCTGAAACCATTGCTTGGCCTCAATATCATAGACAGCGATATCACTGAGAAACTTCTTGTCGACAAGGCCTCCAAACACGACAACCTTAGATTTCCCGAT
ATTAACAGCGGAGTGGCCACTGCGACGTTGGGGAGGGGTTCCGGCGAAATCCGAAGAATTAGCACTAACCCAATAATACATTTTTCTACTGCTTTGTTTG
TAATACCTTCTGTTCTAATCAAAGGTCTGTGATGTAGTAATACAAATCAAGATCAACCCACTGCACTGTGCTTCTTTTACAAATCTACTCGGGAACAGGG
TGTGAAGTGAACTAATTAACAAAATAATAATAGATTATATAAATAAATACAACAAAGGGAATTCAAAGTAATTCCTTATTTTAACTCCAATCAATTTTTT
GAAGATTGAAGATAATGTACCGGAGGAAGAAGATAACAATAGAGAAAAAAAAAGAAAAAACTCGTATTTTCTCAAGCTAAGATAAAAATCTGTGACTATT
TGTCCATTGGCGTATGGAGTCAATGATTGTTCAGTATCACATGTTTCTCATAATTAAACTTTCTTGAGCTAACTTAAATGCCCAAACTTATTTCCCTTGT
TTTGAAAAGCAACTAGCGTGTAAAGTTATTCTACTATTGCATTGTTAGCTACTATTTTTAACTGTTTGTTCGAAAACATGATTTATTACGGATATGTCAT
TTATGATTATAACATAATTGACTTTTCCAATTTGATCATCAATGCATATTTGCCCACAGACTGCAAGCTTTTTGATGTGAAATTGTAGGTCCTTTGCTAT
AACTCATATTGTTAACATACATGTTCTAATTGTTTTACAGTGCACAAGCTCACTCCTTGAATGAGGTAATTGGGGGAAGATTTCTTGTTGG
Putative annotation
RNGB_DICDI RNGB_DICDI Q:1678-905,H:47-311 29.67%ID E:2e-21 RecName: Full=RING finger protein B; Eukaryota; Amoebozoa; Mycetozoa; Dictyosteliida; Dictyostelium`RNGB_DICDI RNGB_DICDI Q:1312-716,H:14-211 23.9%ID E:6e-10 RecName: Full=RING finger protein B; Eukaryota; Amoebozoa; Mycetozoa; Dictyosteliida; Dictyostelium`RNGB_DICDI RNGB_DICDI Q:1462-755,H:14-248 26.4%ID E:1e-09 RecName: Full=RING finger protein B; Eukaryota; Amoebozoa; Mycetozoa; Dictyosteliida; Dictyostelium
Gene mapping
AT2G36360.2 Galactose oxidase/kelch repeat superfamily protein
Medtr1g492850.1 galactose oxidase/kelch repeat protein
Glyma20g32900.1_PACid:16317667 kelch repeat-containing protein
Functional annotation (GO and Pfam)
GO:
GO:0005737 cellular_component cytoplasm
GO:0008270 molecular_function zinc ion binding
GO:0005515 molecular_function protein binding
Pfam:
PF07646.10 Kelch_2 Kelch motif 19-63 E:1.2e-05
PF13418.1 Kelch_4 Galactose oxidase, central domain 20-58 E:5.2e-09
PF13415.1 Kelch_3 Galactose oxidase, central domain 32-85 E:1.1e-05
PF13854.1 Kelch_5 Kelch motif 74-109 E:3.1e-05
PF13418.1 Kelch_4 Galactose oxidase, central domain 76-125 E:6.2e-08
PF01344.20 Kelch_1 Kelch motif 76-118 E:3.9e-06
PF07646.10 Kelch_2 Kelch motif 77-118 E:7.4e-05
PF13415.1 Kelch_3 Galactose oxidase, central domain 87-134 E:4.8e-10
PF13854.1 Kelch_5 Kelch motif 123-162 E:1.5e-05
PF13418.1 Kelch_4 Galactose oxidase, central domain 126-176 E:6.7e-05
PF01344.20 Kelch_1 Kelch motif 132-168 E:0.00013
PF07646.10 Kelch_2 Kelch motif 132-171 E:7.5e-05
PF13415.1 Kelch_3 Galactose oxidase, central domain 138-184 E:4.3e-09
PF13418.1 Kelch_4 Galactose oxidase, central domain 177-209 E:8.1e-06
PF13415.1 Kelch_3 Galactose oxidase, central domain 189-242 E:6.3e-06
PF13418.1 Kelch_4 Galactose oxidase, central domain 234-289 E:0.00012
PF01344.20 Kelch_1 Kelch motif 234-282 E:8.5e-05
PF13415.1 Kelch_3 Galactose oxidase, central domain 244-299 E:1e-06
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC