Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T20774.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
CATAGAAGCAGCACAATCAGTATACTAAAATAAGCAAAGAAAAGTTGATACATGACATCTACTATAATTTATTCACACTTACACATATCAATTGATTTGT
TCAAAGCACGGCTGCGTACTTGCCTAAAAGATATACAAAGCCCAGCCATGCAGCTGATGGCCTAGATGGTAGGAAGAAAACTTTTCATACGTTAAAACTA
CGCTTACAGAAATAAGGACAGTGACTATTAAAATTACAAACCATATCTTACATTTACAAGAACTTCCAGCCAAAAAAATGAAAATAATGTAAATCGGAGT
TCTGGAAAGAATGCCTACCACGTACCTTCATTTGTCCGCTTGTCAGGTTTCTTTCAATCTTCTATCGGTCCTCTCCCTTTCAATCTTTTATCGTTCCTCT
CCCCCGTCCTTTCCAATTTTGGGGTTCATATGAGTTGTCTTGATTAGTATTTGGTTAGTTTGGTATGCAAGCATCCAACGTCAAATGGACGATTTGCATG
ATTTGAGAAAAATTGCAGTTAGATTAAATTTGTTCAACAACACTTGGAAAACCCCTGTCAAAACTATGGTCATGCAAAAATGGAAATCCCTTTGTTCAGC
GATCAAGAGTCATGTGATTCTTGGTCCATCAAAATTACCCGCTGCTTACCACTCTCTGAGCGGAGACTATCTACCTTATTATATCCTATCTCCACTGAAC
TGTCAGGAGAGAACCACTTCAATAGCACACCAAGATGCACTACGGCAGGAATAAGCTTGAAAAGTAGAGGAGTTGTCACCAGACTAAGAGCTGTGGTGCC
AAGCAGCAGCAGATATAATTTACCCTCAACTAGATGAAGGTTTGAAGCACGACTCAGAAGAACAAAAGCAAATTCTCCTATCTGTGCCATCGACATTCCA
ACAAGTATTGAGGTCTTGTTGTTGTAACCAAATCCTTTCACGACAGATGAAATTATGATTGTTTTTATAACAATCACCAATATTACAGATGCTACCAAAA
TATCAACATGGTTCCAAAGAAAATGAACATGAATCAGCATTCCAATGCTGGCAAGGAAAAGAGCAGCAAAAAGATTGCGAATAGGTTCAATTTGCTCTAG
TGTATGTTGAGCCAGATCAGTGGTTGCAATCATCACTCCGGCAGCAAAGGAACCTAATTCTAGACTTAATCCCAGCTTATCGCTACACCAGGCTACTAGC
AAGCAGAATGCAACAGACGCCAATTGATAGAGTTCATTTGTCTGTGATGAGAGGCTTATCATCAGTTTAAGTAACCATGGAAGGCAAGTGCGAGACAATA
TAGTCAGAACAGAGAGGAAAGCAATCAAAGTCACCAACAGCTTGGTCATTGATAACACTCCTTGAAAAACACCTGAGGTGCCACCCAGAACTGGAAGCAA
TGCAAAGAGCAATCCAACAGCACAATCCTGTAAAATAAGGGTCCCAATTGTGACTTGTCCATGAAGAGCATTAGTGGTATTCTTTTCCATCAAAAACTTC
AAGACCACTGCTGTTGAAGACATGGAAAGGAAAGCACCAACAAAAACCCCTTCTGAAGCTTTACCACCACATAGCGATACAGTAAGTCCACACATGCACA
TAAATAGAAAAATCTGAAGTAGACCTCCAAGAACAGCAACAGCTCGAACAACTCGAAGCTTTGTTGTGGAGAACTCGAGGCCCAATGCAAACAGAAGAAA
TATCACACCAAACTGTGCCACTGTTTCCACCTGCACCATTTCACTGATGAAGTTAAAGCCGCCAGGACCAACTATGGAGCCAGCTAGAAGATATCCGGTT
ATCACCGGTTGTCCAGCAAAAGCAAATGCAACGCCCCCACAAGTTGCTGAAACAATAGCAACTACCAGGTCTGAAATCAATCGTAAATCTAGCTGGAGCA
CCGGATACTTGGATTTAAAGTTAGAAATGATAAAGACATTATCCTTCCGATCTATCAACATTGGGGTATCCTCACCTCTATTGAATACATGATGTAGTTG
AAATGACTTTTCATCTTTTGTGTCATTCTTGTTTGGTGTGACTCGTGCCACAGTTTCCAGAACAGCCTGTTGTTCTGCTACACTGTTGTTGAAACTTCCC
GGATCAGCTGCTTCGTTCTGGTCGTTCTCGGTGAACTCGTGCTCCAGCGCGCGATCAATCATGTCGGCAAAGCTTCCTTCGCGAGGTCGTGAGAGAGAGA
CGTTGGACTCGGTCGCGTTGGCGAGTTCGATCTGATCCGACTCGGTAGGCCGAATAGCAAGTGAGGAGTGAGGAAGCAGAAGGAGCGAGTGGATAATAAC
TAGCAGAACAGGCACCAGCAGCACGAAGTGACTGTCGCCGCAGCACGGGGACGGAGACAGTGATCTTCTCAACGACATTGCTCCGCCGGCACACGTTAGC
AGGTGGCGGTGCGAGTTCGGAGGCGGCGACGACCGTTGGCCACGGAGAGTGACGGTGGCGAAAGAGTTGAGAAGTGCGAGAAAAACTGAACCAAAGAAGA
CGGAGTGAACGAGTTTGAAGTGGTGATTGGTGAAGAGTCAAGTTGCAG
Putative annotation
KEA6_ARATH KEA6_ARATH Q:2189-606,H:68-597 82.58%ID E:0 RecName: Full=K(+) efflux antiporter 6; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis
Gene mapping
AT5G11800.1 K+ efflux antiporter 6
Medtr1g016450.1 potassium efflux antiporter
Glyma17g34780.1_PACid:16307067 KEA6; potassium ion transmembrane transporter/ potassium:hydrogen antiporter
Functional annotation (GO and Pfam)
GO:
GO:0016021 cellular_component integral component of membrane
GO:0016020 cellular_component membrane
GO:0015299 molecular_function solute:proton antiporter activity
GO:0006813 biological_process potassium ion transport
GO:0015299 molecular_function solute:proton antiporter activity
GO:0006812 biological_process cation transport
GO:0055085 biological_process transmembrane transport
GO:0016021 cellular_component integral component of membrane
Pfam:
PF00999.16 Na_H_Exchanger Sodium/hydrogen exchanger family 172-541 E:1.8e-76
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC