Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T00663.2 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
GATGGCCCATGCAAATTCCAAAAACAGACACCTTTCCCAGAATTTTCTTCACTGTTTCAACTGCATAAGGAACAGCAGATGGATCTCCAGGGCCATTGCT
GAAAAGCACCCCATCAGGATTCATCTTCAAAGTTTCTGTTGCTGGCCACGTCGATGGTACAACAGTGATTTTGCAGCCATAAGACGCCAAACGCTTAAGT
ATATTATGCTTGATTCCAAAATCATAAGCAACAACATGGAAAGTCTCTCCACTCCCTCCAGAACTAAAATCCCATTCTTGCTTTGTTTTATCAACCCATT
CATGCACAGTTTGACATGATACTCCACTTATTAAATCAATACCAACAATGTCCCAAGAACGAGACATCTTAAGTAGTTCCTCATCTGTTATAGAATTGTC
GGTACTCAACACACCAATAAGGCTGCCATCTTGTCGTAATCTGCGTGTGATAGCCCGTGTGTCAACATCATAAATTCCCATGATATTCCTTTCTGATAAG
TAACCACTTAAAGTTTCTACACATCTCCAGCTTGAGGTACTGATGCTTAAACTTCTAATTACTAGACCAGCAAGGAAGCACTTTCTTGATTCCTCATCAT
CAAAATTTACACCAGTGTTACCAATATGCGGGTTTGTCATCAGCACAAATTGACCAGCATAACTAGGATCTGTTAGAATTTCTTGATACCCAGTCAATGA
TGTATTAAAAACCACTTCACCCACTTGGGTTCCTGAAGCACCAAACGACTTTGCTTTCCAGATTGATCCATCTTCTAACACAAGCCTAGCATCCGAAGTT
TTCCAAGGCCTTTCACCCTTCTTAGCAGAGCATCTGATAATTAAGGCGCAAAGCCTAGGTGGCGACTTGGAACCGACGAGGTGACTCAGAGGCACACCGA
CGCCCAAAGATTTTGCTGCCATTGCCACCTAGAACCGTTCTGAAATCACTTCTGTTCAGGTTCGGATTATGGTTTTTTCTTTTCTTTTTTTCCATGAAAG
TTGTCCTTTTATGTTTCTTGTTCTGTCGTTTTGAGAACAGATACCACTCGTTTTCATACACATTTTTTTTTTCTTTTTCTGTTTTTCTTTTCTGTAGTAG
TCCTGCGGAAGCTGAGATTTGATGAGCTTGTGGCAGTGATTGTACTGAAGGTTTAAT
Putative annotation
CARA_ORYSJ CARA_ORYSJ Q:814-2,H:69-339 79.7%ID E:6e-160 RecName: Full=Carbamoyl-phosphate synthase small chain, chloroplastic; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP clade; Ehrhartoideae; Oryzeae; Oryza
Gene mapping
AT3G27740.1 carbamoyl phosphate synthetase A
Medtr4g103830.1 carbamoylphosphate synthase small subunit
Glyma05g32190.1_PACid:16260394 CARA (CARBAMOYL PHOSPHATE SYNTHETASE A); carbamoyl-phosphate synthase (glutamine-hydrolyzing)/ carbamoyl-phosphate synthase/ catalytic
Functional annotation (GO and Pfam)
GO:
GO:0009507 cellular_component chloroplast
GO:0005524 molecular_function ATP binding
GO:0004088 molecular_function carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity
GO:0044205 biological_process 'de novo' UMP biosynthetic process
GO:0006526 biological_process arginine biosynthetic process
GO:0070409 biological_process carbamoyl phosphate biosynthetic process
GO:0006543 biological_process glutamine catabolic process
Pfam:
PF00988.17 CPSase_sm_chain Carbamoyl-phosphate synthase small chain, CPSase domain 44-172 E:1.2e-50
PF00117.23 GATase Glutamine amidotransferase class-I 233-307 E:5.7e-17
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC