Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T22691.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
TGAGAAAATGATGGCTTTCAGTGTTTTGACCCCATATTATGATGAGGAAGTTTTGTATAGCAAAGAGTCTCTCCGAAAGGAGAATGAGGATGGTATTACT
ACCTTATTTTATCTGCAAAAGATTTATGAAGATGAATGGAAAAATTTTATGGAAAGGATGCAAAGAGAAGGGTTGAAAGATGAGGATGATATCTGGACTA
CAGAAAAGGCCAGGGATCTCCGCCTTTGGGTATCTCATAGAGGTCAAACTTTGTCTCGCACAGTTAGAGGAATGATGTATTATTATCGGGCTCTGAAGAT
GCTGGCGTTCCTTGACTCCGCCTCTGAAATGGACGTGAGACATGAATCAGAACATACTGTTTCACATAGTTCAACAAACCAAAACAACAGCTTAAATGGC
CTATCCGCAAATGGGCCTTCATCTTTACGGACAAATCTCAGGCCAGCAGATAGCAGTGTGTCCACGTTATTCAAGGGACATGAATATGGGAGTGCACTGA
TGAAATTCTCGTATGTGGTGGCATGCCAAATGTATGGGCACCACAAGGCAGACAAGAATCCCCGTGCTGATGAAATATTGTATTTGATGCAAAATAATGA
GGCCCTTAGAGTGGCTTATGTTGATGAGGTTTCTTTAGGGAGGGAGGGAACTGAATATTACTCTGTTCTTGTGAAGTATGATCAGCAGTTGCAGAGGGAG
GTTGAGATTTACCGGATCCGGTTGCCCGGTCCTTTAAAACTTGGAGAAGGGAAACCAGAAAATCAGAATCATGCCATAATCTTTACACGGGGTGATGCAG
TTCAGACCATTGATATGAATCAAGACAATTATTTTGAGGAAGCTCTCAAAATGCGGAATCTGCTAGAGGAGTTCAATACGAACTATGGTGTTAGCAAACC
AACCATTTTAGGGGTCCGAGAAAATGTCTTCACAGGATCAGTTTCGTCGCTTGCATGGTTCATGTCAGCTCAAGAGACAAGCTTTGTGACACTAGGTCAG
CGTGTTCTGGCAAACCCTTTGAAAGTACGAATGCACTATGGCCATCCAGATGTGTTTGACAGATTCTGGTTCTTGGGTCGTGGTGGAGTTAGCAAGGCCT
CCAGAGTGATCAATATCAGTGAAGATATTTTTGCTGGTTTCAATTGTACCCTGCGAGGTGGCAATGTTACACACCACGAATATATACAGGTAGGCAAAGG
AAGAGATGTTGGTTTGAATCAAATATCCATGTTTGAGGCTAAGATTTCTAGTGGCAACGGTGAGCAGGTTCTGAGCCGAGATGTGTACCGTCTAGGCCAT
AGATTAGACTTCTTTCGCATGCTTTCAGTGTTCTACACGACCATTGGATTTTATTTTAACTCAATGGTTATTGTACTGATGGTTTATGCCTTCCTCTGGG
GCCGCCTTTATATGGCTCTCAGTGGAATTGAGGGTGCGGCCTCGGATAATGCAACAAACAATGAAGCCCTTGGTGCAGTTCTAAATCAACAGTTTGCAAT
CCAGGTTGGTATTTTCACTGCACTCCCAATGATCGTTGAAAACTCTCTGGAGCACGGTTTCCTTTCAGCTCTTTGGGACTACTTGACGATGCAATTGCAG
CTTGCATCACTATTTTACACATTCTCTTTGGGAACTCGCACACATTTCTTTGGTCGGACTATACTTCATGGTGGCGCTAAGTACCGAGCCACTGGTCGTG
GTTTTGTTGTGGCACACAAGAGTTTTGCTGAGAACTATAGACTATATGCTCGAAGCCATTTTGTGAAGGGTATTGAACTTGGGGTTATTTTAATTGTGTA
TGCTGCTCATAGTCCCTTGGCTAAGGATACTTTTGTGTACATAGCTATGACAATCTCATGCTGGTTTCTTGTCCTCTCATGGATAATGTCTCCTTTTGTC
TTTAACCCCTCTGGATTTGATTGGTTGAAGACTGTATACGACTTTGAAGATTTTATGAATTGGATATGGTATCCAGGTGGGCCCTTCAAAAAGGCAGAAT
ATAGCTGGGAAACGTGGTGGTACGAGGAGCAAGATCATTTAAAAACAACCGGTATATGGGGAAAGCTGTTAGAAATCATTTTAGACCTTCGATTCTTCTT
CTTTCAGTATGGCATTGTTTATCAGCTAGGTATTGCAGGTGGAAATACTAGTATAGCTGTTTACTTGTTGTCTTGGATAGTCATGGTTGTGATTGTTGCC
ATTTATATTACCATAGCATATGCCAGGGATAAATATGCTACAAAGGAGCACATATATTACCGATCAGTTCAGCTTCTTGTGATCCTAGTCACAGTTCTTG
TAGTTTTCCTCCTACTGGAATTCGCTCATTTAAAATTTGTTGATCTCCTATCAAGCTTGTTAGCATTCGTTCCAACAGGATGGGGAATGATTTTAATAGC
CCAGGTGCTTAGGCCATTTCTACAGACAACCAAAGTGTGGGAGACTGTTGTTTCTTTGGCTCGTCTATATGATTTGTTGTTTGGCATAATTGTTATGGCT
CCAATGGCTATATTCTCATGGTTACCTGGATTCCAATCAATGCAAACTAGAATTCTCTTTAATGAAGCTTTCAGCAGAGGTCTCCAGATATCTCGAATAG
TTAGTGGCAAGAAGTCTGTTTAAGGTGGTGATTGGAGGTTGACCTAAAATAAAAGGGCTACTATGCCGAGTTGCTGAGATGTGTTTCTGTATATTCCCAG
GTGGTAGTATCAACATTGATAGTGAACCCGTATAACTTACCATTATCTAACACAAGATTGAGGACCAACCACTAATGGCAAGTCAAAGCTCGTTGTATGC
AGTGGCAAATGGATGCCTACAGATAATGTCGTGTATGTACACATAAAAAACAGAACACTTGTTTCTTGACTCAATTACAATACAATTTTAAAGCTGCATC
CATGTAACTCTTTAAATATTTGATGAGTCACGTTTTTATTGTTTTAACAAGGTCAATATTGTATCGAGTGTGTCAAAAGTTGTTCATTTTGGGTCATCCA
AGTTCTCTCTTTGCTAATTACTATAAAGTGTTTTTTTTCTTTTGCATGCCGCAAATATTTGTGAAAGTTAGACAAAATATGCACATGCCTTTCACATTAC
CTAAAGACACGTATACAGATTAATGTTAATCTTAATTATTTTAGTTGGATATATCAGTATCACTATCTTTTACCATAGTCTTAATACTCATATTTATACT
TCATAGAATTCTTTTTAATTCTTTCTAATTCAAATTGGTGTTTTTATTTTCAGGTATTGTTATGTGAAAACGTAAA
Putative annotation
CALSB_ARATH CALSB_ARATH Q:2-2617,H:899-1767 76.03%ID E:0 RecName: Full=Callose synthase 11; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis
Gene mapping
AT4G04970.1 glucan synthase-like 1
Medtr2g013580.1 callose synthase-like protein
Glyma15g08020.1_PACid:16298036 "GSL1 (GLUCAN SYNTHASE-LIKE 1); 1,3-beta-glucan synthase/ transferase, transferring glycosyl groups"
Functional annotation (GO and Pfam)
GO:
GO:0000148 cellular_component 1,3-beta-D-glucan synthase complex
GO:0016021 cellular_component integral component of membrane
GO:0005886 cellular_component plasma membrane
GO:0003843 molecular_function 1,3-beta-D-glucan synthase activity
GO:0006075 biological_process (1->3)-beta-D-glucan biosynthetic process
GO:0071555 biological_process cell wall organization
GO:0007623 biological_process circadian rhythm
GO:0009555 biological_process pollen development
GO:0008360 biological_process regulation of cell shape
GO:0000003 biological_process reproduction
GO:0003843 molecular_function 1,3-beta-D-glucan synthase activity
GO:0006075 biological_process (1->3)-beta-D-glucan biosynthetic process
GO:0000148 cellular_component 1,3-beta-D-glucan synthase complex
GO:0016020 cellular_component membrane
Pfam:
PF02364.10 Glucan_synthase 1,3-beta-glucan synthase component 1-751 E:3.2e-237
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC