Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T15113.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
GTTGGTATCTTCTCTCTAGCGCCTTGGAGTAACAGAAATGCCTAAGCTCAAATACAATCGCTTTCTCAGTTTCTTTTACAAATACATGTATAAATAATTA
TGAAACACTCACACCCTTACAACAAAAGAAACCCATCTTTTATTTCAATAATTCATTAAATCTCTATCCGAATCCAGAATTTTCCCATGATTCCTTCTTC
TCTTCTCCATCTACAGATACAGCAGACACTGTTCAGAGGAAAAGTGTGTGGAGAAGATATATTAAGAGATACCAATATGGTTATATCAGTGGCTTCTTCT
TGGTGGTGAATTTCATGGAATGACAGAATTGAATAAGAGCACATGATAAGTCTCAATGATGGGGTCCTTTCACGTAGAGAAGAAATGGCAATTTCCTCTC
ATTATGATCTCAATTGTTTTCATATTCTTTCTAGCAACTTGCTTCAACATGGGGCTTGTCTCTACAATTCACAGCTTCAATTCAATATTATTCTTTCTCC
CATCTCGCCTAGCCATAAACCAGTCTGCTCCAGTTTTTGTGGAGACAAAGATTCCTTCTACAGCTCCAGGTCCTACTGTGCTTGCAATTCCTCGTTTTGC
TTATTTGATTTCTGGCTCAAAAAATGACTTGGAGAAGCTTTGGAGAACTCTTCTAGTCCTTTACCATCCCCTGAACCATTATATTGTTCATTTGGACCTT
GAGTCACCACTAGAGGTGAGGTTGGAGCTTGCTTCTAGAATTGAGAAACAGCCTATTTTCTCTGAGGTTGGGAATGTTTTCATGATTCAGAAAGCTAATA
TGGTCACTTACAGAGGACCAACCATGATTTCTCACACTCTTCATGCTTGTGCCATTCTGCTCAAGAGAACTAAGGACTGGGATTGGTTTATTAACCTCAG
TGCTTCAGATTACCCTCTCGTGACTCAGGATGATCTTCTATATACTTTTTCTGATGTAGACAGAAGCCTTAACTTCATTGAGCACACAAGTCATTTGGGA
TGGAAGCAGGAAAAACGGGCAATGCCTTTAATTATTGATCCAGGTCTTTACAGGACAAACAAGTCTGATGTTTTTTGGGTTGGTCCTAAGAGAACTTTGC
CAACAGCATTTAAATTATTTACTGGTTCAGCATGGATGGTTTTATCACGCTCCTTTGTAGAATATGTTGTGTGGGGTTGGGATAATCTTCCAAGGACCCT
TCTCATGTACTACACTAATTTCATCTCCTCCCCTGAAGGCTACTTTCAGACTGTGATATGCAATGAGCCAGAACTAGCCAAAACTATTGTGAACAGTGAC
TTGCATTATATTTCATGGGACAATCCCCCCAAACAGCACCCTCATGTCCTTACAATCAATGACACAAACAAGATGATTGCAAGCAAAGCTGCTTTTGCAA
GGAAATTCAAGCACAATGATCCAGTCTTGGATGAGATTGATAAACAATTACTAAATAGGGAAAAGGAACAACTATTCACCCCAGGTGGTTGGTGTTCTGG
GAATCCGACATGTTCAAAGGTTGGCAACATTTACAAGATTACACCTGGTCCTGGATCTCGAAGGCTGCGCTTCCTTGTAACTAGGCTAACTTGGATGGCT
AAATTTGGTCAGAAACAGTGTAAATAGATATGTTGTGGGAATTTTTATTGTTAAAGAGTTAGAGGAGTGAAACAGATTAAGGTCACTTTAATGGCCAGAT
ATTTCACTCCAACATTCAGTCCATACCTTAAATTGCAGGGTACAACAGTCCTAGATATGAACATAGTCAAAGTTCACACCTGACACCATTTCAGTTTTAA
AGGTGGAAAGAGAGTCACAGTGTTGATTGAGAATTTTCGCAGTTAGTTCAAAAATATATCATTAGTTTCAAATTCTAGTGGTTCAAAGAAAATTTTGGTA
GTTAGTTCAAATTATA
Putative annotation
XYLT2_MOUSE XYLT2_MOUSE Q:542-1558,H:220-549 28.73%ID E:2e-19 RecName: Full=Xylosyltransferase 2; Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea; Muridae; Murinae; Mus; Mus
Gene mapping
AT3G15350.2 "Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein"
Medtr2g085300.1 core-2/I-branching enzyme
Glyma12g25250.1_PACid:16288097 glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein
Functional annotation (GO and Pfam)
GO:
GO:0005789 cellular_component endoplasmic reticulum membrane
GO:0000139 cellular_component Golgi membrane
GO:0016021 cellular_component integral component of membrane
GO:0008375 molecular_function acetylglucosaminyltransferase activity
GO:0030158 molecular_function protein xylosyltransferase activity
GO:0030206 biological_process chondroitin sulfate biosynthetic process
GO:0006024 biological_process glycosaminoglycan biosynthetic process
GO:0015012 biological_process heparan sulfate proteoglycan biosynthetic process
GO:0030210 biological_process heparin biosynthetic process
GO:0030166 biological_process proteoglycan biosynthetic process
GO:0008375 molecular_function acetylglucosaminyltransferase activity
GO:0016020 cellular_component membrane
Pfam:
PF02485.16 Branch Core-2/I-Branching enzyme 81-340 E:1.8e-72
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC