Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T01185.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
GTCACTCCATATCATATAAATTGACTAATAACTCTATCATTCATAGTATTCATTGTATGATGTAGAATTTCAATTAGTTTCCACAAAAGACATTCATATA
TAATAATATGTGCACATTCTCAACAGTTAGAGCAAGCATGAAGAATATCAAAGCTAGCTAAGACTGCACATAAGTAGAGGAACACTTCAATAATGCATCG
TAGTGGCCATAACCATGATAAATAACTCCAATAGGGTTCTCCTTCCCATATTCCTCACCGTATTCAGCTATAACTTTAAGGTTACTCGAATTCTTATCCT
GCATCACCACTGTTATTGGCATCTGTAAAACATGTGAGGACATGAGAAGTTCAGGTTCTCCTCCCCATATGTGAGGTTTTCTCATCTGTACCGTATAGGT
CTCAAAGTCACCTTCTAGAAACCACTCTGTGTCTGCCCTCCTCTTGATGAATTCATCAACAACTTTGGCTCTAAGTTCATCTGCAAGTTCTTTTTGTCTA
CTAAGACTTGGAGATGGTTCACCTGATCTGAGGCATGCACCATACACCACAGCCCTAAACAAACATCTACCATCTCCTGGAATGCCGAGCGATTTTTCTG
TCTGTGGCATCACTTGGCAAACTAATGCCAAACCAGGTACTGCATAAATTAAGAAAAAGAATAACAGTATATTGCTGTTGTCTTTTTGAGTTTTTTTGGA
GTGTGGATTATCAGGCATTTCCTCCAAACTTTACTACTCCTTTTCATCTATTCTTTTGCTTGATTTGTGGCATAAATTTCAGCACCACACTGCAGAATCT
GGTTCTTTTTTTTCTTCT
Putative annotation
OTU_ARATH OTU_ARATH Q:589-188,H:171-304 67.91%ID E:2e-63 RecName: Full=OTU domain-containing protein At3g57810; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis
Gene mapping
AT3G57810.1 Cysteine proteinases superfamily protein
Medtr3g085620.1 OTU-like cysteine protease
Glyma11g37230.1_PACid:16285679 OTU-like cysteine protease family protein
Functional annotation (GO and Pfam)
GO:
GO:0009507 cellular_component chloroplast
Pfam:
PF02338.14 OTU OTU-like cysteine protease 47-173 E:2.5e-19
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC