Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T22214.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
CCCGAAAACAATTCTTTATACACCACTGTTTATGTTGGCAACCTTCCTCATGATGTAAGTTATGTGGATTGAAGAATGAAATATTATGGTTATTATTTTC
ACATTGTAAGGACAAAAACTTTGTTTAATTTCTATATTCAAAAATATGGAAAAAATATTTAGGTATTTTCTAGGATTGATCTGGCTTATTAGAATTAGCT
TTAAACGTAGTTTTGGATGGATTGCTGAGGGGTGCATATTTTACAATGGTGTATATCTGAACCACCCTTGTTTAAAGTGCCAGAAAAATGCCATAAGATG
TATAAGTTAGTTCCCATTGCAGGCTTTTCAACATAATGACTTACATGCAGTTAAAGGACAGACATGCTTTGGCCTTTCAAGCATTAATTGACCCGAACTT
AAATTATTGTATTCAAAATTCGTGCTTAATTTTGTTCTAGTTGTCGATCCATGTGTTATGATATTTCTTATAACTTTTCAAATGTGTTTTTGAATTTGGC
ATTGGCAATAGTGACCCAGGTTTCTTAGAGTGTCACCTCCACCCTAGATTGGTATTGCAATCCTGTAAAAAAAACGTGTCTTTACATCTGGGGAGCAGTT
ATCTGTCGTGGTTTGTGGTTTATTCACAACTTCATCGATCTCTTTCATCATTGAGTCTTATCTGCTGCCTCTTGGTTTGGATCTGTTCTCGAAGAGAATG
AGGGCCATCCCAGTGATTTGTGGGGAACTGCTGATATGGTGAAGGCATTTGTTATGCGTCACATGTTTGCCGAACTCCTTGCAACCATATTATTGTTTCT
TCTTCGTCTGATGCAGTCCATAATTCAAAATCCTGGTTGAAAACAAATTTTGTGTTAATTTATGAAAACCTTTTTCCAGCATTTAGTCCTCCTTCCTAGC
ATCTACTTGTTGAATGTGTCAAATCTGTAACAGCATTTCTCCATATTGATTGATCTGAATGTCAGTCTTGCATTTTATTACAAATCATGAACTGTTCCGT
TTACACGATTCTTACACGTGGTTTGAGGGTAACAGGTAACACAAGCTGAACTCCATTGCCAATTCCATGCACTGGGGGCTGGGGTAATTGAGGAGGTTCG
AGTTCAAAGGGATAAGGG
Putative annotation

Gene mapping

Medtr3g109090.3 nucleolysin TIAR-like protein
Glyma06g08200.1_PACid:16262153 UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding
Functional annotation (GO and Pfam)
GO:
Pfam:
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC