Noble Research Institute, LLC   Shanghai center for Plant Stress Biology   Noble Research Institute | VuGea  
      Vigna unguiculata Gene expression atlas  
 
     
Transcript Details

Vun_T23399.1 Predicted as a transcription factor  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Add to Multi-transcript Viewer (MTV)  Customize slides (experiments)    View co-expressed transcripts
Sequence: ( How to interprete )
GGGTGTAGATTACGAGTTTGTTGAAGAGACCTTGAATCCCAAAAGTGAACTTCTTCTTAAGTCCAACCCTGTGCACAAGAAAATTCCAGTTCTCCTCCAT
GAAGATAAAGCCATATGTGAATCTGCAATCATAGTTGAATACATTGATGAAGTTTGGTCCAATGTTCCCTCCATCCTTCCACAAAATGCATATGATCGAG
CTAATGCCCGATTTTGGGTTGCTTACATCGATGACAAGTGGTTTTCGGCCTTGAAAAGTATTCTAATGGCTGAAGAGAATGATGAAGCAAAGGAGGCACC
GTTTGAGGAAGCAGCAGAAGTGTTTGAGAGGATGGAAGAAGTGATGAACAAGGGAAGTGAAGGGAAGGTCTTTTTCGGAGGAGACACCATTGGATTCATT
GATATTGGTTTTGGAAGCTTTCTGAGTTGGATCAGAGTGGTGGAGAAGATGAATGCACGAAAATTGCTTCATGAAACCAAGCACCCTCGCTTGATCCAAT
GGACTGAAAATTTTGCTGCTCATCCTGCTGTCAATGGTCTTATACCAGACACCGACAAGCTTATTGAACTTGCTAAGGCTTTTAGGCAAACATTACGGGC
TAGTGCAGCTGCAAACTAAATGGAAATTTAGAAATTTTAGTTGTTTTTGGTTCTAACTTTATGTTGGCATGAACTTTAGTTTAAAATAAAACTCAAAACA
AAAAGGGTTTTGGTTTAAAAATAAAGAAGAGATTACTGGGAATTTCTTTGTTCTTGAGTTTAAGGATGTCTTCCATCAGAGAGTTCTAATCTCACTTCCT
ACTTCTGTTGTTTTCTTAGGTTGTTTTTCTCTCTTTGTATGTCATGTCTTATGTTGTATAAAATAATGGGAAAATTACTGTTGTCTTCCTCAAGCTATCT
TTCAATTTCAACACTATTATTCTCTTGAAAGTTAAACTATATATTTTTTATTGCTTGGAGATTTTCATTATTAAATTGTAACGTTGTATGCACTATCAAC
TTTATACTATTAAAAAACCTCACGCGGTTTTTTATATTACCACACACCTATCCTCACTGAAAGATACAAGTATTATATTATCTTTCTCTATTATGTTAAA
ATATAAAACAAATTACATTTCTTTTCTTTTTCTCAGATATGCAATTTTATTTTCTCTTTCACACGTAACATCAATATAGAATATCCAGGTTTTTAATTAT
ATTAAATTTTTTTTTTTAATTTACCATGTATCGTTCACTCACTATTGTTTAAAAGAAAGCTGACCCAACATGAAATCCAACACATGGCATAAGGAAAAGC
GAACTACAAACACATTCGTATGCCGTGTGTGATCCATCTCCAACTATATACATTATAAATAGAAAATCACAAATGCTTATTCATGTAATGTATGTATTTT
AAAGAATGAATATGAATACTTTGATTCCAAATGCCATATAAAATATTTTTCTTATGAATCATTTGATTACTCTTACCGCAACTGTGTGGAGGCCTAAGCG
TTTAGCTGTCTGTAAATTGCGGATGCTGTCATCAAA
Putative annotation
GSTUI_ARATH GSTUI_ARATH Q:2-577,H:28-219 54.92%ID E:1e-45 RecName: Full=Glutathione S-transferase U18; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis
Gene mapping
AT1G10360.1 glutathione S-transferase TAU 18
Medtr5g037380.1 "glutathione S-transferase, amine-terminal domain protein"
Glyma01g04710.1_PACid:16243419 ATGSTU18 (GLUTATHIONE S-TRANSFERASE TAU 18); glutathione transferase
Functional annotation (GO and Pfam)
GO:
GO:0005737 cellular_component cytoplasm
GO:0005829 cellular_component cytosol
GO:0004364 molecular_function glutathione transferase activity
GO:0009636 biological_process response to toxic substance
GO:0009407 biological_process toxin catabolic process
GO:0005515 molecular_function protein binding
Pfam:
PF13417.1 GST_N_3 Glutathione S-transferase, N-terminal domain 1-51 E:9.8e-08
PF02798.15 GST_N Glutathione S-transferase, N-terminal domain 1-50 E:2.7e-07
PF00043.20 GST_C Glutathione S-transferase, C-terminal domain 72-175 E:2.8e-09
PF13410.1 GST_C_2 Glutathione S-transferase, C-terminal domain 101-169 E:9.8e-06
Transcription factor prediction and categorization
Family:
Interpro domain:
 
         
       
© Noble Research Institute, LLC